Piltdown Man Hoax

On December 18, 1912, bones believed to be of ancient primate origin were discovered in Piltdown, England by an amateur archaeologist by the name of Charles Dawson. The fragments of bone they discovered consisted of a jawbone, teeth, and the piece of a skull. It was later discovered that Charles Darwin and accomplices tampered with the find and modified the pieces of the discovery. Pointy canine teeth were discovered but filed down to maintain the appearance that the skull was of human lineage.

On November 1953, Time Magazine publishes an expose on the Piltdown Man. Kenneth Page Oakley, Sir Wilfrid Edward Le Gros Clark, and Joseph Weiner are the men who proved the Piltdown Man was a Hoax. Ultimately they discovered it actually consisted of a human skull (Medieval Period),  a 500 year-old orangutan jawbone, and fossil chimpanzee teeth. The bones were stained with iron solution and chromic acid to appear legitimate.

The technology that developed in that time frame helped to expose the hoax. Scientists were eager to conclude with Charles Dawson because Briton was eager for an important find in human evolution.

The human faults that came into play here were pride, envy, and a craving for prestige. Among these faults there were genuine human motives untainted by societal pressures like genuine curiosity. Charles Dawson, being an archaeologist, already had a strong curious nature about bone discovery. The fault came when he realized his evidence was moot and tried to stifle truth and scientific progression. His pride kept him from admitting that the bones were not of human origin. He took it so far as to falsify evidence and maintained this hoax for nearly 40 years.  In Charles' lifetime he received prestige, credibility, fame, and fortune but it was all  a lie.

Thanks to science's self-correcting nature, natural skepticism, and methodology helped to expose this farce. Methods like fluorine absorption test, and other dating techniques helped to prove that the pieces of bone had varying origins.

It's not possible to remove the human element of scientists performing science. Curiosity and a drive for knowledge will always initiate the pursuit. The promise of importance, money, and fame are things that lure scientists to falsify evidence and to sabotage their integrity. It's important that we conduct our own due diligence on anything we find important and of interest. Science asks us to go based on evidence and not hearsay.

Locomotor Patterns in Primates

ABC: Locomotor Patterns

 a. A thorough description of the environment in which the primates lives. (10 pts total)

Lemurs (Prosimians/Strepsirhini)

-          Lemurs live in the tropical forest of Madagascar. In fact, lemurs are exclusive to the forest on the island of Madagascar and are found nowhere else (naturally) on earth. They are found primarily in the secondary forests.

Spider Monkey (New World Monkey/Platyrrhini)

-          Spider monkeys reside in the tropical forests of Central and South America. They are found all the way from Southern Mexico to Brazil in said tropical rainforests. Spider monkeys need large areas of moist evergreen forests and prefer undisturbed primary forest. They live in the upper layers of the rainforest and forage in the high canopy.

Baboon (Old World Monkey/Cercopithecidae)

-           Baboons are primarily found in lower-central part of Africa. They reside in Zambia, Botswana, Democratic Republic of Congo, and Mozambique. They prefer African woodland savannas.   

Gibbon (Lesser ape/Hylobatidae)

-          Gibbons are found in tropical and subtropical rainforests from northeast India to Indonesia, northern and southern China, including the islands of Sumatra, Borneo, and Java.

Chimpanzee (Great ape/Hominidae)

-          Chimpanzees are found in west and central Africa. They can be located on either side of the Congo River. Their natural habitats are mainly rainforests. They do most of their eating and sleeping in the forest canopy.  They also reside in swamps, savannas, woodlands, and bamboo forests. They move about both in trees and on the ground equally.

  

b. A description of your specified character trait for that primate. (10 pts total)

Lemurs (Prosimians/Strepsirhini)

-          Arboreal quadrupedalism, terrestrial  quadrupedalism, leaping and suspension.

Spider Monkey (New World Monkey/Platyrrhini)

-          Arboreal quadrupedalism, terrestrial quadrupedalism, brachiation, leaping and suspension.

Baboon (Old World Monkey/Cercopithecidae)

-          Arboreal quadrupedalism and terrestrial  quadrupedalism

Gibbon (Lesser ape/Hylobatidae)

-          Arboreal quadrupedalism, terrestrial  quadrupedalism, brachiation, and suspension.

Chimpanzee (Great ape/Hominidae)

-          Arboreal quadrupedalism, terrestrial quadrupedalism, knuckle walking, bipedalism brachiation, and leaping.

c. A discussion on how the primate’s trait expression has been influenced by its environment, i.e., how can the trait be viewed as an adaptation to the primate’s environment. (10 pts total)

Lemurs (Prosimians/Strepsirhini)

-          Lemurs’ environment is very thick with branches and greenery as far as they eye can see.  Their terrestrial quadrupedalism is used to scour for fruit, nuts, leaves, and insects on the forest floor. Arboreal quadrupedalism is used to maneuver through the trees and to be well suited to movement on trees. Leaping and suspension are used to quickly move from tree to tree.

Spider Monkey (New World Monkey/Platyrrhini)

-          Spider monkeys’ environment is extremely dense and lush with plant life in every direction.  Their terrestrial quadrupedalism is secondary to their arboreal quadrupedalsm. Terrestrial quadrupedalism is used to scour for food on the forest floor. Arboreal quadrupedalism and brachiation is for superior maneuverability through the thick branches. They swing from branch to branch as well as leaping and suspend.

Baboon (Old World Monkey/Cercopithecidae)

-          Baboons are not the most agile of the monkeys. They mainly exercise their arboreal quadrupedalism and terrestrial  quadrupedalism. This most likely has to do with the fact that they spend a lot of time in savannas which aren't known for dense tree population. They move through the trees with ease but not nearly as well as spider monkey. They do a lot of terrestrial quadrupedalism to gather food on the ground. Berries, figs, fruits, insects, smaller monkeys, and smaller animals are all part of the baboons environment.

Gibbon (Lesser ape/Hylobatidae)

-          Considering that Gibbons live in dense rainforests it makes sense that they’ve developed such long arms. With these long arms they are able to use brachiation to travel quickly and efficiently through the rainforest.

Chimpanzee (Great ape/Hominidae)

-          Chimpanzees are the most versatile of the monkeys. They are found in multiple climates and environments. This versatility may explain why they exhibit an extraordinary amount of intelligence. They are known to fashion tools which was previously thought to be a trait exclusive to humans. Diverse environments explains why the chimpanzee has excellent locomotor skills and can adapt to a wide array of environments.

d. An image of that primate, preferably displaying the trait you are studying, if possible. (5 pts total)

Lemurs (Prosimians/Strepsirhini)

Spider Monkey (New World Monkey/Platyrrhini)

Baboon (Old World Monkey/Cercopithecidae)

Gibbon (Lesser ape/Hylobatidae)

Chimpanzee (Great ape/Hominidae)

Homology & Analogy

1. For your homologus traits provide the following information

a. Briefly describe the two different species that possess the homologous trait.

Humans and bats share the homologous trait of an arm and hand. Both are complete with carpal bones and phalanges. Their hands, unlike many other mammals, have opposable thumbs (mainly in megabats).

b. Describe the homologus trait of each species, focusing on the differences in structure and function of the trait. Why do these homologus traits exhibit differences between the two species? Make sure your explanation is clear and complete.

Human thumbs are covered in flesh while bats’ thumbs are covered in fur. Humans use their opposable thumbs for grabbing, handling, and manipulating objects while bats use their opposable thumbs for climbing trees to find the highest point to take flight from.

Human thumbs are adapted to using tools while bats use theirs to only interact with natural obstacles rather than fashioning their own tools.

c. Who was (generally, not specifically) the common ancestor of these two species and how do you know that ancestor possessed this homologus trait?

The common ancestor of humans and bats is the Vertebrata. Vertebrata are known to have developed appendages that have evolved over time with each species. Vertebrates are distinguishable by their spinal column.

d. Provide an image of each species in this comparison.

2. For your analogous traits provide the following information

a. Briefly describe the two different species that possess the analogous trait.

Birds and Butterflies share the analogous trait of wings which allow them to fly through the air with the utmost ease.

b. Describe the analogous trait of each species, focusing on the similarities in structure and function of the trait. Clearly explain why these analogous traits exhibit similarities between the two species.

Birds and butterflies soar through the air with agility, grace, and swiftness. This allows them to spot food with ease and constantly avoid predation.

c. All pairs of organisms share some common ancestor if you go back far enough in time. Did the common ancestor of these two species possess this analogous trait? Why or why not?

No. The ancestors of both birds and butterflies did not necessarily start out with wings. Birds evolved from a reptile without wings, and butterflies evolved from an arthropod without wings. 

d. Provide an image of each species in this comparison. (5 pts)

Decode my DNA!

ACATACCATAGTCAAGAGAGCAACGTTCTGGTTATCTCC